|
Virovek Inc
the aav-mcherry control vector The Aav Mcherry Control Vector, supplied by Virovek Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/the aav-mcherry control vector/product/Virovek Inc Average 90 stars, based on 1 article reviews
the aav-mcherry control vector - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
|
General Biosystems Inc
adeno-associated virus (aav) negative control virus (nc) Adeno Associated Virus (Aav) Negative Control Virus (Nc), supplied by General Biosystems Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/adeno-associated virus (aav) negative control virus (nc)/product/General Biosystems Inc Average 90 stars, based on 1 article reviews
adeno-associated virus (aav) negative control virus (nc) - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
|
Applied Biological Materials Inc
scrambled aav sirna control viral vector (serotype 5 ![]() Scrambled Aav Sirna Control Viral Vector (Serotype 5, supplied by Applied Biological Materials Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/scrambled aav sirna control viral vector (serotype 5/product/Applied Biological Materials Inc Average 90 stars, based on 1 article reviews
scrambled aav sirna control viral vector (serotype 5 - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
|
Genechem
overexpression plasmids of nfib and pink1 ![]() Overexpression Plasmids Of Nfib And Pink1, supplied by Genechem, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/overexpression plasmids of nfib and pink1/product/Genechem Average 90 stars, based on 1 article reviews
overexpression plasmids of nfib and pink1 - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
|
Genechem
control recombinant aav green fluorescence protein (gfp) vector 9 (aav shctrl ![]() Control Recombinant Aav Green Fluorescence Protein (Gfp) Vector 9 (Aav Shctrl, supplied by Genechem, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/control recombinant aav green fluorescence protein (gfp) vector 9 (aav shctrl/product/Genechem Average 90 stars, based on 1 article reviews
control recombinant aav green fluorescence protein (gfp) vector 9 (aav shctrl - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
|
Hengyu Inc
quality control assays of recombinant aav vectors ![]() Quality Control Assays Of Recombinant Aav Vectors, supplied by Hengyu Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/quality control assays of recombinant aav vectors/product/Hengyu Inc Average 90 stars, based on 1 article reviews
quality control assays of recombinant aav vectors - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
|
Genechem
shrna lentiviruses for cav-1 targeting homo sapiens cav-1 mrna ![]() Shrna Lentiviruses For Cav 1 Targeting Homo Sapiens Cav 1 Mrna, supplied by Genechem, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/shrna lentiviruses for cav-1 targeting homo sapiens cav-1 mrna/product/Genechem Average 90 stars, based on 1 article reviews
shrna lentiviruses for cav-1 targeting homo sapiens cav-1 mrna - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
|
Vigene Biosciences
aav vector serotypes expressing gfp under control ubiquitous promoter cytomegalovirus ![]() Aav Vector Serotypes Expressing Gfp Under Control Ubiquitous Promoter Cytomegalovirus, supplied by Vigene Biosciences, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/aav vector serotypes expressing gfp under control ubiquitous promoter cytomegalovirus/product/Vigene Biosciences Average 90 stars, based on 1 article reviews
aav vector serotypes expressing gfp under control ubiquitous promoter cytomegalovirus - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
|
Obio Technology Corp Ltd
control vectors (aav-control and aav-scrambled) ![]() Control Vectors (Aav Control And Aav Scrambled), supplied by Obio Technology Corp Ltd, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/control vectors (aav-control and aav-scrambled)/product/Obio Technology Corp Ltd Average 90 stars, based on 1 article reviews
control vectors (aav-control and aav-scrambled) - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
|
Shanghai Genechem Ltd
aav vectors carrying cgas shrna or control shrna ![]() Aav Vectors Carrying Cgas Shrna Or Control Shrna, supplied by Shanghai Genechem Ltd, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/aav vectors carrying cgas shrna or control shrna/product/Shanghai Genechem Ltd Average 90 stars, based on 1 article reviews
aav vectors carrying cgas shrna or control shrna - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
|
Obio Technology Corp Ltd
aav of the negative control and dj-1 overexpression vectors ![]() Aav Of The Negative Control And Dj 1 Overexpression Vectors, supplied by Obio Technology Corp Ltd, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/aav of the negative control and dj-1 overexpression vectors/product/Obio Technology Corp Ltd Average 90 stars, based on 1 article reviews
aav of the negative control and dj-1 overexpression vectors - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
|
Genechem
the aav vector encoding scrambled shrna (negative control) ![]() The Aav Vector Encoding Scrambled Shrna (Negative Control), supplied by Genechem, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/the aav vector encoding scrambled shrna (negative control)/product/Genechem Average 90 stars, based on 1 article reviews
the aav vector encoding scrambled shrna (negative control) - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
Image Search Results
Journal: International Journal of Molecular Sciences
Article Title: Hmgb1 Silencing in the Amygdala Inhibits Pain-Related Behaviors in a Rat Model of Neuropathic Pain
doi: 10.3390/ijms241511944
Figure Lengend Snippet: Effects of siHmgb1 pre- and post-treatment on mRNA expression levels in the CeA. ( A ) Hmgb1 siRNA AAV pooled viral vector (siHmgb1) or scrambled siRNA AAV control viral vector (scramble) was stereotaxically delivered into the right CeA of male and female rats as a 2-week pre-treatment ( A ) or 1-week post-treatment ( B ) to SNL surgery. At the chronic (4 week) phase of the SNL model, the brains were extracted and the left and right CeA were dissected out for mRNA validation. qRT-PCR analysis of mRNA expression levels for Hmgb1 was performed on left and right CeA tissues. ( A ) No significant differences were seen in Hmgb1 mRNA expression in either the left or the right CeA following siHmgb1 pre-treatment compared to scramble control for male (siHmgb1, n = 10; scramble, n = 8) and female (siHmgb1, n = 14; scramble, n = 14) SNL rats. ( B ) Hmgb1 mRNA expression was significantly downregulated in the right but not left CeA following siHmgb1 post-treatment compared to the scramble control in male (siHmgb1, n = 10; scramble, n = 6) and female (siHmgb1, n = 6; scramble, n = 10) SNL rats. mRNA expression of NF-κB, a downstream signaling molecule of Hmgb1, was also downregulated in the right but not left CeA following siHmgb1 post-treatment compared to the scramble control in male and female SNL rats. *, **, *** p < 0.05, 0.01, 0.001, two-way ANOVA with Šidák’s post hoc tests, compared to the same-sex scramble control. Gene expression fold change calculated using the 2 −ΔΔCt method, geometric mean of β-actin, Rpl3, and Rpl29 used as internal markers. Bar histograms show the mean ± SEM.
Article Snippet: A stereotaxic apparatus (David Kopf Instruments, Tujunga, CA, USA) was used to inject 1 µL of either Hmgb1 AAV siRNA viral vector of 4 pooled oligomers (serotype 5) (originally purchased as cat. #234960960215, now cat. #23496164, customized to serotype; Applied Biological Materials, Richmond, BC, Canada; target sequences: 70 CGGGAGGAGCACAAGAAGAAGCACCCGGA, 196 GCTGACAAGGCTCGTTATGAAAGAGAAAT, 365 TTGGTGATGTTGCAAAGAAACTAGGAGAG, 442 GCTGCCAAGCTGAAGGAGAAGTATGAGAA) or the scrambled
Techniques: Expressing, Plasmid Preparation, Quantitative RT-PCR
Journal: International Journal of Molecular Sciences
Article Title: Hmgb1 Silencing in the Amygdala Inhibits Pain-Related Behaviors in a Rat Model of Neuropathic Pain
doi: 10.3390/ijms241511944
Figure Lengend Snippet: Cell type-specific effects of siHmgb1 post-treatment in the right CeA. Hmgb1 siRNA AAV pooled viral vector (siHmgb1) or scrambled siRNA AAV control viral vector (scramble) was stereotaxically delivered into the right CeA of male rats as a 1-week post-treatment to SNL surgery. For immunohistochemical studies, the brains were extracted from male rats at the chronic (4 weeks) phase of the SNL model (3 weeks after siHmgb1 or scramble injection). For each of the three cell types in the right CeA (neurons, GFAP+ astrocytes, and Iba1+ microglia), the Hmgb1 signal was evaluated by averaging the mean grey values (MGV) from each individual cell. Compared to rats injected with the scramble control viral vector, rats injected with siHmgb1 showed a reduction in Hmgb1 MGV per cell by 1.9 times in neurons and 2.5 times in astrocytes. There was no statistically significant difference in Hmgb1 signal for microglia. The field of analysis contained more neuronal cells than other cell types. ***, **** p < 0.001, 0.0001, ns, not significant, unpaired t -test. Error bars show the means ± SEM. Scale bar, 40 μm.
Article Snippet: A stereotaxic apparatus (David Kopf Instruments, Tujunga, CA, USA) was used to inject 1 µL of either Hmgb1 AAV siRNA viral vector of 4 pooled oligomers (serotype 5) (originally purchased as cat. #234960960215, now cat. #23496164, customized to serotype; Applied Biological Materials, Richmond, BC, Canada; target sequences: 70 CGGGAGGAGCACAAGAAGAAGCACCCGGA, 196 GCTGACAAGGCTCGTTATGAAAGAGAAAT, 365 TTGGTGATGTTGCAAAGAAACTAGGAGAG, 442 GCTGCCAAGCTGAAGGAGAAGTATGAGAA) or the scrambled
Techniques: Plasmid Preparation, Immunohistochemical staining, Injection
Journal: International Journal of Molecular Sciences
Article Title: Hmgb1 Silencing in the Amygdala Inhibits Pain-Related Behaviors in a Rat Model of Neuropathic Pain
doi: 10.3390/ijms241511944
Figure Lengend Snippet: Effects of Hmgb1 siRNA pre-treatment in the right CeA on chronic neuropathic pain behaviors. ( A ) Hmgb1 siRNA AAV pooled viral vector (siHmgb1) or scrambled siRNA AAV control viral vector (scramble) was stereotaxically delivered into the right CeA of male (siHmgb1, n = 8; scramble, n = 10) and female (siHmgb1, n = 14; scramble, n = 14) rats as a pre-treatment 2 weeks before SNL surgery. Pain-related behavioral assays were performed 4 weeks after SNL surgery. ( B ) No significant differences were observed in siHmgb1 pre-treated male and female SNL rats in sensory withdrawal thresholds (measured by electronic von Frey and paw compression of the affected hind paw) compared to the scramble control. Emotional-affective responses were measured by the duration (s) of audible ( C ) or ultrasonic ( D ) vocalizations evoked by a brief (10 s) normally innocuous (100 g/6 mm 2 ) or noxious (500 g/6 mm 2 ) mechanical compression of the affected hind paw. Ultrasonic vocalization duration in response to innocuous stimulation was significantly decreased in siHmgb1 pre-treated males only ( D ); no significant effects were seen for males in audible vocalizations ( C ) or in females for audible ( C ) and ultrasonic ( D ) vocalizations. Anxiety-like behaviors measured by the center duration and number of center entries in the OFT, ( E ) and open arm duration and open arm entries in the EPM ( F ) were not significantly affected by siHmgb1 pre-treatment in male or female SNL rats compared to the scramble control. No significant differences were observed in the distance traveled within the OFT for male or female SNL rats following siHmgb1 pre-treatment compared to the scramble control ( E ). ** p < 0.01, two-way ANOVA with Šidák’s post hoc tests, compared to the same-sex scramble control. Bar histograms show the mean ± SEM. Experimental protocol figure created with BioRender.com , https://www.biorender.com/ (accessed on 8 May 2023).
Article Snippet: A stereotaxic apparatus (David Kopf Instruments, Tujunga, CA, USA) was used to inject 1 µL of either Hmgb1 AAV siRNA viral vector of 4 pooled oligomers (serotype 5) (originally purchased as cat. #234960960215, now cat. #23496164, customized to serotype; Applied Biological Materials, Richmond, BC, Canada; target sequences: 70 CGGGAGGAGCACAAGAAGAAGCACCCGGA, 196 GCTGACAAGGCTCGTTATGAAAGAGAAAT, 365 TTGGTGATGTTGCAAAGAAACTAGGAGAG, 442 GCTGCCAAGCTGAAGGAGAAGTATGAGAA) or the scrambled
Techniques: Plasmid Preparation
Journal: International Journal of Molecular Sciences
Article Title: Hmgb1 Silencing in the Amygdala Inhibits Pain-Related Behaviors in a Rat Model of Neuropathic Pain
doi: 10.3390/ijms241511944
Figure Lengend Snippet: Effects of Hmgb1 siRNA post-treatment in the right CeA on chronic neuropathic pain behaviors. ( A ) Hmgb1 siRNA AAV pooled viral vector (siHmgb1) or scrambled siRNA AAV control viral vector (scramble) was stereotaxically delivered into the right CeA of male (siHmgb1, n = 19; scramble, n = 20) and female (siHmgb1, n = 20; scramble, n = 20) rats as a post-treatment 1 week after SNL surgery. Pain-related behavioral assays were performed 4 weeks after SNL surgery. ( B ) Sensory withdrawal thresholds (measured by electronic von Frey and paw compression of the affected hind paw) were increased by siHmgb1 post-treatment in male and female SNL rats compared to the scramble control. Emotional-affective responses were measured by the duration (s) of audible ( C ) or ultrasonic ( D ) vocalizations evoked by a brief (10 s) normally innocuous (100 g/6 mm 2 ) or noxious (500 g/6 mm 2 ) mechanical compression of the affected hind paw. Audible and ultrasonic vocalization duration in response to normally innocuous stimulation was significantly decreased in siHmgb1 post-treatment males only; audible and ultrasonic vocalization duration evoked by noxious stimulation was significantly decreased in both males and females following siHmgb1 post-treatment when compared to the scramble control. Anxiety-like behaviors measured by center duration and number of center entries in the OFT ( E ) and open arm duration and open arm entries in the EPM ( F ) were not significantly affected by siHmgb1 post-treatment in male or female SNL rats compared to the scramble control. No significant differences were observed in the distance traveled in the OFT for male or female SNL rats following siHmgb1 post-treatment when compared to the scramble control ( E ). *, **, ***, **** p < 0.05, 0.01, 0.001, 0.0001, two-way ANOVA with Šidák’s post hoc tests, compared to the same-sex scramble control. Bar histograms show the mean ± SEM. Experimental protocol figure created with BioRender.com , https://www.biorender.com/ (accessed on 8 May 2023).
Article Snippet: A stereotaxic apparatus (David Kopf Instruments, Tujunga, CA, USA) was used to inject 1 µL of either Hmgb1 AAV siRNA viral vector of 4 pooled oligomers (serotype 5) (originally purchased as cat. #234960960215, now cat. #23496164, customized to serotype; Applied Biological Materials, Richmond, BC, Canada; target sequences: 70 CGGGAGGAGCACAAGAAGAAGCACCCGGA, 196 GCTGACAAGGCTCGTTATGAAAGAGAAAT, 365 TTGGTGATGTTGCAAAGAAACTAGGAGAG, 442 GCTGCCAAGCTGAAGGAGAAGTATGAGAA) or the scrambled
Techniques: Plasmid Preparation
Journal: PeerJ
Article Title: NFIB promotes the migration and progression of kidney renal clear cell carcinoma by regulating PINK1 transcription
doi: 10.7717/peerj.10848
Figure Lengend Snippet: (A) Important KEGG pathways of differentially expressed genes in three datasets. (B) Potential binding sites of NFIB on the PINK1 gene promoter. After being transfected with NFIB vector or NC vector, respectively, the expression of PINK1 mRNA and protein in LoMet-ccRCC and 786-0 cells were analyzed by (C) qRT-PCR and (D) western blot assay respectively. After being transfected with NFIB siRNA or NC siRNA, respectively, the expression of PINK1 mRNA and protein in LoMet-ccRCC and 786-0 cells were analyzed by (E) qRT-PCR and (F) western blot assay respectively. (G) CHIP experiment was performed by using the NFIB and IgG antibodies to probe LoMet-ccRCC cells extracts, and the level of the co-precipitated RNAs were determined by using qRT-PCR. The data C, E and G were presented as means ± SD of three independent experiments. Values are significant at * P < 0.05, as demonstrated by paired Student’s t test.
Article Snippet: The overexpression plasmids of NFIB and
Techniques: Binding Assay, Transfection, Plasmid Preparation, Expressing, Quantitative RT-PCR, Western Blot
Journal: PeerJ
Article Title: NFIB promotes the migration and progression of kidney renal clear cell carcinoma by regulating PINK1 transcription
doi: 10.7717/peerj.10848
Figure Lengend Snippet: After co-transfection with NFIB vector and PINK1 siRNA or NC siRNA respectively, the expression of PINK1 mRNA and protein in LoMet-ccRCC and 786-0 cells were measured by (A–B) qRT-PCR and (C) western blot assay respectively. The proliferative capacity in LoMet-ccRCC cells were analyzed by (D) MTT and (E–F) colony formation assay (1×). The migration ability in LoMet-ccRCC cells were analyzed by (G–H) transwell assay, (I–J) invasion assay and (K–L) wound healing assay (200×), Scale bars = 100 µm. All data were presented as means ± SD of three independent experiments. Values are significant at * P < 0.05, as demonstrated by paired Student’s t test.
Article Snippet: The overexpression plasmids of NFIB and
Techniques: Cotransfection, Plasmid Preparation, Expressing, Quantitative RT-PCR, Western Blot, Colony Assay, Migration, Transwell Assay, Invasion Assay, Wound Healing Assay
Journal: PeerJ
Article Title: NFIB promotes the migration and progression of kidney renal clear cell carcinoma by regulating PINK1 transcription
doi: 10.7717/peerj.10848
Figure Lengend Snippet: After co-transfection with NFIB sgRNA and PINK1 vector or NC vector respectively, the expression of PINK1 protein in LoMet-ccRCC and 786-0 cells were measured by (A) western blot assay. The proliferative capacity in 786-0 cells were analyzed by (B) MTT and (C–D) colony formation assay (1×). The migration ability in 786-0 cells were analyzed by (E–F) transwell assay, (G–H) invasion assay and (I–J) wound healing assay (200×), Scale bars = 100 µm. All data were presented as means ± SD of three independent experiments. Values are significant at * P < 0.05, as demonstrated by paired Student’s t test.
Article Snippet: The overexpression plasmids of NFIB and
Techniques: Cotransfection, Plasmid Preparation, Expressing, Western Blot, Colony Assay, Migration, Transwell Assay, Invasion Assay, Wound Healing Assay
Journal: Redox Biology
Article Title: XBP1 deficiency promotes hepatocyte pyroptosis by impairing mitophagy to activate mtDNA-cGAS-STING signaling in macrophages during acute liver injury
doi: 10.1016/j.redox.2022.102305
Figure Lengend Snippet: Hepatocyte-derived mtDNA promoted macrophage STING activation in a cGAS-dependent manner. (A–C) WT and HKO mice were pre-treated with AAV-cGAS-shRNA or AAV-control-shRNA 7 days before TAA administration. (A) STING staining of liver tissue sections. Scale bar, 50 μm . (B) Intrahepatic macrophages were isolated and protein levels of cGAS, STING, P-TBK1, P-IRF3, P–NF- κ B and β -actin were analyzed using western blotting. (C) Serum cytokine/chemokine levels (IL-1 β , IL-18, MCP-1 and CXCL-10) were measured using ELISA. (D and E) BMDMs were transfected with cGAS-siRNA or non-specific siRNA (Control) lentiviral particles and then stimulated with 100 ng/ml of mtDNA. Protein levels of cGAS, STING, P-TBK1, P-IRF3, P–NF- κ B and β -actin were measured using western blotting (D). (E) BMDMs were treated with Cy5-dCTP-tagged mtDNA (100 ng/ml) for 12 h and stained with F4/80 (green), STING (red), and Hoechst 33,342 (blue). Scale bar, 100 μm . Data are presented as the mean ± SEM (n = 4). *P < 0.05 , **P < 0.01 , ***P < 0.001 . NS, not significant. (For interpretation of the references to colour in this figure legend, the reader is referred to the Web version of this article.)
Article Snippet: For knockdown cGAS or overexpression of PINK1, the AAV vectors carrying cGAS shRNA or
Techniques: Derivative Assay, Activation Assay, shRNA, Control, Staining, Isolation, Western Blot, Enzyme-linked Immunosorbent Assay, Transfection